View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5054_low_12 (Length: 241)
Name: NF5054_low_12
Description: NF5054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5054_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 6082442 - 6082249
Alignment:
| Q |
18 |
gttagaaaaaggttaaaattacctacctcttcattttcatatgaagtaagatttgctttgtctgtttctaaaattgttttctcccttgtctttttccccc |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6082442 |
gttagaaaagggttaaaattacctacctcttcattttcatatgaagtaagatttgctttgtctgtttctaaaattgttttctcccttgtctttttccccc |
6082343 |
T |
 |
| Q |
118 |
actcccactgcttttgatccattaggagaattagccttcaaattatgctgattctgcatgcatattttggtcaaggaaaaaattatatactgct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6082342 |
actcccactgcttttgatccattaggagaattagccttcaaattatgctgattctgcatgcatattttggtcaaggaaaaaattatatactgct |
6082249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University