View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5054_low_3 (Length: 452)
Name: NF5054_low_3
Description: NF5054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5054_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 2e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 333 - 442
Target Start/End: Original strand, 1160916 - 1161025
Alignment:
| Q |
333 |
aaggtctggcctctttggtggcagctttgctggtctgttggaggcggtgctaaggggttgaattttgatggttcataattggatttcagagccatagctc |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1160916 |
aaggtctggcctctttggtggcagctttgctggtctattggaggcggtgctaaggggttgaattttgatggttcataattggatttcagagccataactc |
1161015 |
T |
|
| Q |
433 |
aagcctctgt |
442 |
Q |
| |
|
|||||||||| |
|
|
| T |
1161016 |
aagcctctgt |
1161025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 334 - 405
Target Start/End: Complemental strand, 21113827 - 21113756
Alignment:
| Q |
334 |
aggtctggcctctttggtggcagctttgctggtctgttggaggcggtgctaaggggttgaattttgatggtt |
405 |
Q |
| |
|
|||||||| ||||| |||||| ||||||||| |||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
21113827 |
aggtctggggtcttttgtggcaactttgctgggctgttggaggcggtgctatggggttgaattttggtggtt |
21113756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University