View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5054_low_8 (Length: 299)
Name: NF5054_low_8
Description: NF5054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5054_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 11 - 281
Target Start/End: Original strand, 48011857 - 48012137
Alignment:
| Q |
11 |
cagagaccatagacaaatcttccaccccttcttcagaatactcatttgtgactcttttgtctttgtgttggtttccatagtacccttcagttccacctat |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48011857 |
cagaaaccatagacaaatcttccaccccttcttcagaatactcatttgtgactcttttgtctttgtgttggtttccatagtacccttcagttccacctat |
48011956 |
T |
 |
| Q |
111 |
gaatctagtgtcttcataagaatgttcaaggtatagagtccaacctgactcacatccactactacattcagaatcaaatgcactcatgttccttttttca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
48011957 |
gaatctagtgtcttcataagaatgttcaaggtatagagtccaacctgactcacatccactactacattcagaatcaaatgcactcatgtt-catttttca |
48012055 |
T |
 |
| Q |
211 |
attc-ttct---------ttctag-ctatggagaagagttttctacttttctagtgtatgatgaaattaagaaaggctaggt |
281 |
Q |
| |
|
|||| |||| |||||| ||| || |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48012056 |
attctttctacctatagattctagtatatagaaaagagttttctacttttctagtgtatgatgaaattaagaaagactaggt |
48012137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University