View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5055-Insertion-6 (Length: 52)
Name: NF5055-Insertion-6
Description: NF5055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5055-Insertion-6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr2 (4 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 45; Significance: 1e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-17
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 3931490 - 3931534
Alignment:
| Q |
8 |
catgcttcctttttagcaatagcttcacccttctcaggatcattc |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3931490 |
catgcttcctttttagcaatagcttcacccttctcaggatcattc |
3931534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-17; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-17
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 33082341 - 33082385
Alignment:
| Q |
8 |
catgcttcctttttagcaatagcttcacccttctcaggatcattc |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33082341 |
catgcttcctttttagcaatagcttcacccttctcaggatcattc |
33082385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-17
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 33092201 - 33092245
Alignment:
| Q |
8 |
catgcttcctttttagcaatagcttcacccttctcaggatcattc |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33092201 |
catgcttcctttttagcaatagcttcacccttctcaggatcattc |
33092245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 1e-17
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 33099697 - 33099741
Alignment:
| Q |
8 |
catgcttcctttttagcaatagcttcacccttctcaggatcattc |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33099697 |
catgcttcctttttagcaatagcttcacccttctcaggatcattc |
33099741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.0000000000009
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 33072605 - 33072649
Alignment:
| Q |
8 |
catgcttcctttttagcaatagcttcacccttctcaggatcattc |
52 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
33072605 |
catgcttccttcttagcaatagcttcacccttctcagaatcattc |
33072649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University