View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5055_high_13 (Length: 267)
Name: NF5055_high_13
Description: NF5055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5055_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 36 - 109
Target Start/End: Complemental strand, 16756516 - 16756443
Alignment:
| Q |
36 |
atgaatttatgatggtggtgtgtgatgaatttatgaatttgggagaagaagatatgaagattcctggagatgaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16756516 |
atgaatttatgatggtggtgtgtgatgaatttatgaatttgggagaagaagatatgaagattcatggagatgaa |
16756443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 212 - 252
Target Start/End: Complemental strand, 16756312 - 16756272
Alignment:
| Q |
212 |
tgggtttattattaatagaaatcaatggtgatgatgatgat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16756312 |
tgggtttattattaatagaaatcaatggtgatgatgatgat |
16756272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 52077608 - 52077704
Alignment:
| Q |
1 |
ttatgaatttcgttttcagtgatgatggtgtagggatgaatttatgatggtggtgtgtgatgaatttatgaatttgggagaagaagatatgaagattcct |
100 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52077608 |
ttatgaatttctttttcagtgatggtggtgtagggatgaatttatgatggtggtgtgtg--------atgaatttgggagaagaagatatgaagattcct |
52077699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 13 - 109
Target Start/End: Original strand, 3616348 - 3616436
Alignment:
| Q |
13 |
ttttcagtgatgatggtgtagggatgaatttatgatggtggtgtgtgatgaatttatgaatttgggagaagaagatatgaagattcctggagatgaa |
109 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3616348 |
ttttcagtgatggtggtgtatggatgaatttatgatggcggtgtctgatga--------atttgggagaagaagatatgaagattcctggagatgaa |
3616436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 12666923 - 12666996
Alignment:
| Q |
1 |
ttatgaatttcgttttcagtgatgatggtgtagggatgaatttatgatggtggtgtgtgatgaatttatgaattt |
75 |
Q |
| |
|
||||||||||| ||||| |||||| |||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12666923 |
ttatgaatttctttttctgtgatggtggtgtagtgatgaatttatgatggtggtgtgtgatg-atttatgaattt |
12666996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 211 - 250
Target Start/End: Original strand, 52077842 - 52077881
Alignment:
| Q |
211 |
ctgggtttattattaatagaaatcaatggtgatgatgatg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52077842 |
ctgggtttattattaatagaaatcaatggtgatgatgatg |
52077881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 211 - 252
Target Start/End: Original strand, 3616566 - 3616607
Alignment:
| Q |
211 |
ctgggtttattattaatagaaatcaatggtgatgatgatgat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3616566 |
ctgggtttattattaatagaaatcaatggtgatcatgatgat |
3616607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University