View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5055_high_19 (Length: 228)
Name: NF5055_high_19
Description: NF5055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5055_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 210
Target Start/End: Original strand, 3032216 - 3032411
Alignment:
| Q |
15 |
cacagagatctttccaattgtttctttgcagattttgaattgctatataggtgaaatatgtaaaagcaagactggaccggagatcgaaactgtgagacca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3032216 |
cacagagatctttccaattgtttctttgcagattttgaattgctatataggtgaaatatgtaaaagcaagactggaccggagatcgaaactgtgagacca |
3032315 |
T |
|
| Q |
115 |
atcatggttcacttgattcgatcacttcaactgattgaaccaaccaaatttaaccgtctcgttgaactagttaagtcaaattaccttgtaacccaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3032316 |
atcatggttcacttgattcgatcacttcaactgattgaaccaaccaaatttaaccgactcgttgaactagttcagtcaaattaccttgtaacccaa |
3032411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 114 - 210
Target Start/End: Complemental strand, 20061428 - 20061332
Alignment:
| Q |
114 |
aatcatggttcacttgattcgatcacttcaactgattgaaccaaccaaatttaaccgtctcgttgaactagttaagtcaaattaccttgtaacccaa |
210 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||||||||||||||||| ||||||||||||| |||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
20061428 |
aatcatggttcaattgattcaatcgtttcaactgattgaaccaacttaatttaaccgtcttgttgaactagttcaatcaaattacattgtaacccaa |
20061332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 81
Target Start/End: Complemental strand, 20061594 - 20061536
Alignment:
| Q |
24 |
ctttccaattgtttctttgca-gattttgaattgctatataggtgaaatatgtaaaagc |
81 |
Q |
| |
|
|||| ||||| ||| |||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20061594 |
cttttcaattatttttttgcatgattttgaattgctatataggtgaaatatgtataagc |
20061536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University