View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5055_low_17 (Length: 251)
Name: NF5055_low_17
Description: NF5055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5055_low_17 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 13410644 - 13410880
Alignment:
| Q |
13 |
gagatattatgtataggggtcagaatttaaatttcggattgccaacttcttcacacattatatgtatgaatttagtcactagactacttcaagnnnnnnn |
112 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13410644 |
gagatattatgtataggggtcggaatttaaattccagattgccaacttcttcacacattatatgtatgaatttagtcactagactacttgaa--aaaaaa |
13410741 |
T |
 |
| Q |
113 |
tcaatttattaacgaccaaaaaatgtgattgtgagtggagtttgtggtggaaagtgaaaaagtaattctgcttaagctatatggaagaaactggaaccca |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13410742 |
tcaatttattaacgaccagaaaatgtgattgtgagtggagtttgtggtggaaagtgaaaaagtaattctgcttaagctatatggaacaaactggaaccca |
13410841 |
T |
 |
| Q |
213 |
ttaatatcatatttatttgaaaacgtgcaatcatgaatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13410842 |
ttaatatcatatttatttgaaaacgtgcaatcatgaatc |
13410880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 136 - 175
Target Start/End: Original strand, 13487842 - 13487881
Alignment:
| Q |
136 |
tgtgattgtgagtggagtttgtggtggaaagtgaaaaagt |
175 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13487842 |
tgtgattgtgagtggagtttatggtggaaagtgaaaaagt |
13487881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 13602873 - 13602916
Alignment:
| Q |
204 |
tggaacccattaatatcatatttatttgaaaacgtgcaatcatg |
247 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
13602873 |
tggaacccattaatattatatttatttgaaaatgtgcaatcatg |
13602916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 131530 - 131573
Alignment:
| Q |
204 |
tggaacccattaatatcatatttatttgaaaacgtgcaatcatg |
247 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
131530 |
tggaacccattaatattatatttatttgaaaatgtgcaatcatg |
131573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University