View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5055_low_4 (Length: 398)
Name: NF5055_low_4
Description: NF5055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5055_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 6e-87; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 217 - 391
Target Start/End: Original strand, 31991909 - 31992083
Alignment:
| Q |
217 |
ctcaccagttctatggtgaacaatgcgttctgtgtcttgcagagttgcatgttaagggctatatcgacttccaatatcagttcttttgtcgcagtattca |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31991909 |
ctcaccagttctatggtgaacaatgcgttctttgtcttgcagagttgcatgttaagggctatatcgacttccaatatcagttcttttgtcgcagtattca |
31992008 |
T |
 |
| Q |
317 |
gtggtgctggtagttttacgcgtacaacagaaaattaaagacaatattggagtgtcccatgattatattcatctc |
391 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31992009 |
gtggtgctggtagttttacgcttacaacagaaaattaaagacaatatttgagtgtcccatgattatattcatctc |
31992083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 25 - 223
Target Start/End: Complemental strand, 31985803 - 31985609
Alignment:
| Q |
25 |
acataatacataaccctacattatcttctcctcccttccaaaatatattttggtgaaatatttttggattcaacgatcgaaaccatacaacgaaaatcct |
124 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||||||||||||||||| | | ||||||||||||||||| |||||||| ||| |||||| |
|
|
| T |
31985803 |
acataatacataacgctacattatcttttcctcctttccaaaatatattttggtggattttttttggattcaacgatggaaaccattcaatgaaaatgtc |
31985704 |
T |
 |
| Q |
125 |
aaaaacttcttgcaaaatcaatacgcatatataattctctgcagtcacaagttttcaagttctcaaacgaagcagcaacaccaaggaatggcctcacca |
223 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||| |
|
|
| T |
31985703 |
aaaaacttcttgcaaaatcaatacg---acgtaattctctgaagtcacaagttttcaagttctcaaac-aagcagcaacaccaagcaatggccacacca |
31985609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 324
Target Start/End: Original strand, 31992695 - 31992736
Alignment:
| Q |
283 |
acttccaatatcagttcttttgtcgcagtattcagtggtgct |
324 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
31992695 |
acttccaatattagttcttttgtcgcggtattgagtggtgct |
31992736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 215 - 332
Target Start/End: Complemental strand, 49067628 - 49067511
Alignment:
| Q |
215 |
gcctcaccagttctatggtgaacaatgcgttctgtgtcttgcagagttgcatgttaagggctatatcgacttccaatatcagttcttttgtcgcagtatt |
314 |
Q |
| |
|
||||||||| |||||||||| | ||| |||| ||||||||| |||||| || |||||||||||| |||||||||||||||||| ||||||| ||||| |
|
|
| T |
49067628 |
gcctcaccacttctatggtggatgatgtattctatgtcttgcaaagttgcttgcgaagggctatatccacttccaatatcagttctgttgtcgcggtatt |
49067529 |
T |
 |
| Q |
315 |
cagtggtgctggtagttt |
332 |
Q |
| |
|
|| |||||| ||||||| |
|
|
| T |
49067528 |
gagcggtgctagtagttt |
49067511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University