View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5056-Insertion-10 (Length: 222)
Name: NF5056-Insertion-10
Description: NF5056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5056-Insertion-10 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] scaffold0028 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 11 - 222
Target Start/End: Complemental strand, 22072185 - 22071974
Alignment:
| Q |
11 |
tgttgcctccagatggagaactacctaaatatgctcaattttacatatatgacacagagaatgagatacagaacagaattaaaggattcgggtatatatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
22072185 |
tgttgcctccagatggagaactacctaaatatgctcaactttacatatatgacacagagaatgagatacagaacaaaattaaaggattcgagtatatatt |
22072086 |
T |
|
| Q |
111 |
tatcattaatatagaatcaaacttattattagttattgaataaatacaattcataaacctgtagatcattgcatttctaaccatacaaaggatcatttgc |
210 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22072085 |
tataattaatatagaatcaaacttattattacatattgaataaatacaaatcataaacctctagatcattgcatttctaaccatacaaaggatcatttgc |
22071986 |
T |
|
| Q |
211 |
ttttttcaacag |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
22071985 |
ttttttcaacag |
22071974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 25 - 111
Target Start/End: Complemental strand, 118220 - 118134
Alignment:
| Q |
25 |
ggagaactacctaaatatgctcaattttacatatatgacacagagaatgagatacagaacagaattaaaggattcgggtatatattt |
111 |
Q |
| |
|
||||||| ||| || ||||| ||| |||||||||||||||| |||||||||||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
118220 |
ggagaacaaccaaagtatgcccaactttacatatatgacactgagaatgagatacaaaacagaattagaggattcgggtacatattt |
118134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University