View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5056-Insertion-9 (Length: 514)
Name: NF5056-Insertion-9
Description: NF5056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5056-Insertion-9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 46011762 - 46011991
Alignment:
| Q |
16 |
tgtgtgtgttttcttacccttttgcttgttggtttttgtttggtctatctccgtatgatgctattatgtaagggtttagttattaatattgattgtgtta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46011762 |
tgtgtgtgttttcttacccttttgcttgttggtttttgtttggtctatctctgtatggtgctattatataagggtttagttattaatattgattgtgtta |
46011861 |
T |
|
| Q |
116 |
taaggaatgtaacatacacttcgagtcgttttgtgatgttagataaagatttagttactaatattgatgattgtgttataaggaatgtaaaatggacttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46011862 |
caaggaatgtaacatacacttcgagtcgttttgtgatgttagataaagatttagttactaatattgatgattgtgttataaggaatgtaaaatggacttg |
46011961 |
T |
|
| Q |
216 |
gagtcgtttaattaaaaaattattgtatgg |
245 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |
|
|
| T |
46011962 |
gagtcgtttaattagaaaattattgtatgg |
46011991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University