View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5057_high_13 (Length: 304)
Name: NF5057_high_13
Description: NF5057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5057_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 45 - 274
Target Start/End: Original strand, 34899746 - 34899975
Alignment:
| Q |
45 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899746 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
34899845 |
T |
 |
| Q |
145 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899846 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
34899945 |
T |
 |
| Q |
245 |
gtttggtagtttcaactttcaagttgagat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34899946 |
gtttggtagtttcaactttcaagttgagat |
34899975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 9491729 - 9491757
Alignment:
| Q |
1 |
ccctaaccctaaccctaaccctaacccta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9491729 |
ccctaaccctaaccctaaccctaacccta |
9491757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University