View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5059-Insertion-3 (Length: 217)
Name: NF5059-Insertion-3
Description: NF5059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5059-Insertion-3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 24 - 155
Target Start/End: Original strand, 33222193 - 33222324
Alignment:
| Q |
24 |
aatatccctaccaattgagttaagttcacgagaattttgcaaattttattttagtacctcacctaccgcatatttgttcaatacacatatttgaatcacc |
123 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
33222193 |
aatatccctaccaactgagttaagttcacaagaattttgcaaattttattttagtacctcacctcccacatatctgttcaatacacatatttgaatcacc |
33222292 |
T |
|
| Q |
124 |
taaccatctagtttcgatctttctggagctag |
155 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| |
|
|
| T |
33222293 |
taaccatctaatttcgatctttcttgagctag |
33222324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 60
Target Start/End: Original strand, 56479265 - 56479301
Alignment:
| Q |
24 |
aatatccctaccaattgagttaagttcacgagaattt |
60 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
56479265 |
aatatccctaccaactgagttaagttcacgagaattt |
56479301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 28 - 57
Target Start/End: Original strand, 33967932 - 33967961
Alignment:
| Q |
28 |
tccctaccaattgagttaagttcacgagaa |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33967932 |
tccctaccaattgagttaagttcacgagaa |
33967961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 23 - 52
Target Start/End: Original strand, 443990 - 444019
Alignment:
| Q |
23 |
taatatccctaccaattgagttaagttcac |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
443990 |
taatatccctaccaattgagttaagttcac |
444019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University