View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5059_high_7 (Length: 289)
Name: NF5059_high_7
Description: NF5059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5059_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 11 - 270
Target Start/End: Complemental strand, 54276859 - 54276597
Alignment:
| Q |
11 |
catcatcacaatgagaaagaaagagataagaaga---gaaaacaagtttggttaccagagtagttatgaggaagagggagagtagttccttcgagcaacc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54276859 |
catcatcacaatgagaaagaaagagataagaagaagagaaaacaagtttggttaccagagtagttatgaggaagagggagagtagttccttcgagcaacc |
54276760 |
T |
 |
| Q |
108 |
ttcctcgaaaatgcgattgctgtaatggtaaaccgtcttctccgacgacgccggtaggtttaggtttgaaatactgagagacttcagtgggaccatcgtg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54276759 |
ttcctcgaaaatgcgattgctgtaatggtaaaccgtcttctccgacgacgccggtaggtttaggtttgaaatactgagagacttcggtgggaccatcgtg |
54276660 |
T |
 |
| Q |
208 |
cttgatgcagcagggaagtagatgaacacgcccactcagatcctcgataccgtctcgctttag |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54276659 |
cttgatgcagcagggaagtagatgaacacgcccactcagatcctcgataccgtctcgctttag |
54276597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University