View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5059_low_5 (Length: 324)
Name: NF5059_low_5
Description: NF5059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5059_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 271
Target Start/End: Complemental strand, 14794303 - 14794045
Alignment:
| Q |
11 |
attctctggtttttagaggatacttatttgaaaacatatatttaaaagtatgtattgaaaatataatacattactagttttagaannnnnnnnnnnngag |
110 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
14794303 |
attctctggtttttagagaatacttatttgaaaacatatatttaaaagtatgtattgaaaatataatacattaccagttttaga-ttttttttttttgag |
14794205 |
T |
|
| Q |
111 |
ggagaaaatattttttatgaagtggatgtttggatttgaggcgagattagtggaatcgccacgagctttcacaattttggtgcatgctatactttgaaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14794204 |
ggagaaaatattttttatgaagtggatgtttggatttgaggcgagattagtggaatcgccacgagctttcacaattttggtgcatgctatactttgaaac |
14794105 |
T |
|
| Q |
211 |
ttttaacaaaatcatactgtcattttgattttgtcaggaagatatttttaaatagttttta |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
14794104 |
-tttaacaaaatcatactgtcattttgattttgttaggaagatttttttaaatagttttta |
14794045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 270 - 309
Target Start/End: Complemental strand, 14793771 - 14793732
Alignment:
| Q |
270 |
taacaaaattttaaaagactagtttaggggaagttataag |
309 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14793771 |
taacaaaattttaaaagattagtttaggggaagttataag |
14793732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University