View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5059_low_8 (Length: 277)
Name: NF5059_low_8
Description: NF5059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5059_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 272
Target Start/End: Complemental strand, 4010209 - 4009952
Alignment:
| Q |
19 |
aagttgttaatgtgtactagaaaatgctagcaagttctaccatgaaacaaaactttgcctctgtatgcactctactatatcttctcattacaaatgttat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4010209 |
aagttgttaatgtgtactagaaaatgctagcaagttctgccatgaaacaaaactttgcctctgtatgtactctactatatcttctcattacaaatgttat |
4010110 |
T |
 |
| Q |
119 |
caatcacttttcaataaacaaatg---ttagtaaataatggttata-tatttagggttcaaaccctagacctcttacaaaaaattccttcggtgtccctt |
214 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4010109 |
caatcacttttcaataaacaaatgttattagtaaataatggttatattttttagggttcaaaccctagacctcttacaaaaaattccttcggtgtccctt |
4010010 |
T |
 |
| Q |
215 |
atttcgctaaccaaactatctacttgggacttaatctgttcttatctttcttctcact |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4010009 |
atttcgctaaccaaactatctacttgggacttaatctgttcttatctttcttttcact |
4009952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University