View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5060_low_6 (Length: 253)
Name: NF5060_low_6
Description: NF5060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5060_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 29007341 - 29007098
Alignment:
| Q |
1 |
atctcaattgaactcaacgacacaactgcacataacatcaaccctgtacaattcaaatgcaaatgtaatcaacaacatttacacaataaatacacttcga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29007341 |
atctcaattgaactcaacgacacaactgcacataacatcaaccctgtacaattcaaatgcaaatgcaatcaacaacatttacacaataaatacacttcga |
29007242 |
T |
|
| Q |
101 |
ttataacttataattcagcttaaacacgttttcttgtgt--tgtgcaatcgacacgtcaagagcaccgacacttgtgatcgaaaacgtatcagtgaattg |
198 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29007241 |
ttataacttataattcagcttaaacacatttttttgtgtgctgtgcaatcgacacgtcaagagcaccgacacttgtgatcgaaaacgtatc--tgaattg |
29007144 |
T |
|
| Q |
199 |
ta-cattgtcaatatcctgatgcatgtgtttgtgtctgtgcttcat |
243 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29007143 |
tatcattttcaatatcctgatgcatgtgtttgtgtccgtgcttcat |
29007098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University