View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5061_high_17 (Length: 251)
Name: NF5061_high_17
Description: NF5061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5061_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 27244006 - 27243767
Alignment:
| Q |
1 |
cagtggaagtctttagattgatttttcaaccatcatcaagaaaacaatttgatgggatcgattgatcgatcaaatatcatttgtctctacatccttaac- |
99 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27244006 |
cagtggaagtccttagactgatttttcaaccatcatcaagaaaacaatttgatgggatcgattgatcgatcaaatatcatttgtctctacatccttaata |
27243907 |
T |
 |
| Q |
100 |
gttaacaccgcattgtaaattggtgagagagtgatagtgctcttatgatagttgtaaacattgatctattattacctttgagtagtagcaaaggtcccca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27243906 |
gttaacaccgcattgtaaattggtgagagagtgatagtgctcttatgatagatgtaaacattgatctattattacctttgagtagtagcaaaggtcccca |
27243807 |
T |
 |
| Q |
200 |
tttccctctagtaataaaagatagaagtatggtgaatatt |
239 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27243806 |
tttccctctagtaataaaggatagaagtatggtgaatatt |
27243767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University