View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5061_high_18 (Length: 248)
Name: NF5061_high_18
Description: NF5061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5061_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 99 - 230
Target Start/End: Original strand, 27244144 - 27244282
Alignment:
| Q |
99 |
cgaaaatgttgtatttaacgaaaataatttcgtgaaagatagcaaacaaatgtattgttactatagcttctgtgggcctttacaa--------ccactcc |
190 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| || | |||||||||||| ||||||| |
|
|
| T |
27244144 |
cgaaaatgttgtatataacgaaaataatttcgtgaaagatagcgaacaaatgtattgttactatag-ttgttggggcctttacaactttacatccactcc |
27244242 |
T |
 |
| Q |
191 |
acccatgttttgctctcaagagcaaatctaatggtcatag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27244243 |
acccatgttttgctctcaagagcaaatctaatggtcatag |
27244282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University