View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5061_low_13 (Length: 337)
Name: NF5061_low_13
Description: NF5061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5061_low_13 |
 |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-173; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 17 - 331
Target Start/End: Original strand, 24906989 - 24907303
Alignment:
| Q |
17 |
caagttatatgaaaatagaagtaagcatttggttgagagagaagctgtggattacatttctaataagaagaagaaaattatggacgaaagggcaaggtta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24906989 |
caagttatatgaaaatagaagtaagcatttggttgagagagaagctgtggattacatttctaataagaagaagaaaattatggacgaaagggcaaggtta |
24907088 |
T |
 |
| Q |
117 |
aacgtcccatttataatctagagtcgcatgtaacgacgtttctaatataagaagaagaaaaattgtttggtagatggattagatggattttgtactggag |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24907089 |
aacgtcccatttataatctagagttgcatgtaacgacgtttctaatataagaagaagaaaaattgtttggtagatggattagatggattttgtactggag |
24907188 |
T |
 |
| Q |
217 |
ggattggatgattatggatttggtggatcacattgccacccttctgtaacgttactttcattttatacctcggttggttatttgaatttccacattttcc |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24907189 |
ggattggatgattatggatttggtggatcacattgccacccttatgtaacgttactttcattttatacctcggttggttatttgaatttccacattttcc |
24907288 |
T |
 |
| Q |
317 |
ttgagctcattgtta |
331 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
24907289 |
ttgagctcattgtta |
24907303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 179 - 254
Target Start/End: Original strand, 18264575 - 18264650
Alignment:
| Q |
179 |
ttgtttggtagatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgcca |
254 |
Q |
| |
|
||||||| | |||||||| ||||||||||||| |||| |||||||||| ||||||| | ||||||| ||||||| |
|
|
| T |
18264575 |
ttgtttgatggatggattggatggattttgtagtggatggattggatggatatggatctcatggatcatattgcca |
18264650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 23869296 - 23869369
Alignment:
| Q |
174 |
aaaaattgtttggtagatggattagatggattttgtactggagggattggatgattatggatttggtggatcac |
247 |
Q |
| |
|
|||||||||||||| ||||||| ||| ||||||||| |||| || ||||||| |||||||| ||||||||| |
|
|
| T |
23869296 |
aaaaattgtttggtggatggatctgatagattttgtagtggattaatcggatgataatggatttagtggatcac |
23869369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 257
Target Start/End: Original strand, 24823039 - 24823107
Alignment:
| Q |
189 |
gatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
||||||||||||||||||| || | ||| ||||||||| ||||||| | ||||||| |||||||||| |
|
|
| T |
24823039 |
gatggattagatggattttatagtagagagattggatggatatggatctcatggatcatattgccaccc |
24823107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 302
Target Start/End: Complemental strand, 31302526 - 31302245
Alignment:
| Q |
17 |
caagttatatgaaaatagaagtaagcatttggttgagagagaagctgtggattacatttctaataagaagaagaaaattatggacgaaagggcaaggtta |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31302526 |
caagttatatgcaaatagaagtaagcatttggctgagagagaggctgtggaatacgtttctaataagaagaagaaaattatggacgaaagggcaaggtga |
31302427 |
T |
 |
| Q |
117 |
aacgtcccatttataatctagagtcgcatgtaacgacgtttctaatataagaagaagaaaaattgtttggtagatggattagatggattttgtactggag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
31302426 |
aacgtcccatttataatctagagtcgcatgtaacgacatttcta--ataagaag--gaaaaattgtttggtagatgaattagatggattttgtactcgag |
31302331 |
T |
 |
| Q |
217 |
ggattggatgattatggatttggtggatcacattgccacccttctgtaacgttactttcattttatacctcggttggttatttgaa |
302 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
31302330 |
ggattggatggatatggatttggtggatcacattgccacccttatgtaacgttactttaattttatacctcagttggttatttgaa |
31302245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 257
Target Start/End: Complemental strand, 25245051 - 25244983
Alignment:
| Q |
189 |
gatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||| ||||||| | ||||||| |||||||||| |
|
|
| T |
25245051 |
gatggatttgatggattttgtagtggatggattggatggatatggatctcatggatcatattgccaccc |
25244983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 257
Target Start/End: Complemental strand, 25275167 - 25275089
Alignment:
| Q |
179 |
ttgtttggtagatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
||||||| | |||||||| ||||||||||||| |||| |||||||||| |||| || | ||||||| |||||||||| |
|
|
| T |
25275167 |
ttgtttgatggatggattggatggattttgtagtggatggattggatggatatgaatctcatggatcatattgccaccc |
25275089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 257
Target Start/End: Original strand, 46244306 - 46244374
Alignment:
| Q |
189 |
gatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||| ||||| ||||||||| |||||| |||||||||| |
|
|
| T |
46244306 |
gatggattggatggattttgtagtggatggatcggatggatatggatttcatggatctaattgccaccc |
46244374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 179 - 257
Target Start/End: Complemental strand, 26858044 - 26857966
Alignment:
| Q |
179 |
ttgtttggtagatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| |||| ||||||||||| ||||||| | ||||||| |||||||||| |
|
|
| T |
26858044 |
ttgtttgatagatggattggatggattttgtagtggatggattggatgaatatggatctcatggatcatattgccaccc |
26857966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 255
Target Start/End: Original strand, 8933907 - 8933983
Alignment:
| Q |
179 |
ttgtttggtagatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgccac |
255 |
Q |
| |
|
||||||| | |||||||| ||||||||||||| |||| ||||||||||| ||||||| | ||||||| |||||||| |
|
|
| T |
8933907 |
ttgtttgatggatggattggatggattttgtagtggatggattggatgaatatggatctcatggatcatattgccac |
8933983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 257
Target Start/End: Complemental strand, 5708198 - 5708120
Alignment:
| Q |
179 |
ttgtttggtagatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
||||||| | |||||||| ||||||||||||| |||| ||||||||| ||||||| | ||||||| |||||||||| |
|
|
| T |
5708198 |
ttgtttgatggatggattggatggattttgtagtggatagattggatggatatggatctcatggatcatattgccaccc |
5708120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 246
Target Start/End: Original strand, 9272896 - 9272953
Alignment:
| Q |
189 |
gatggattagatggattttgtactggagggattggatgattatggatttggtggatca |
246 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||| ||||||| || ||||||| |
|
|
| T |
9272896 |
gatggattggatggattttgtagtggatggattggatggatatggatctgatggatca |
9272953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 257
Target Start/End: Original strand, 10369651 - 10369719
Alignment:
| Q |
189 |
gatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||| ||||| ||||||||| |||||| |||||||||| |
|
|
| T |
10369651 |
gatggattggatggattttgtagtggatggatcggatggatatggatttcatggatctaattgccaccc |
10369719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 257
Target Start/End: Original strand, 14385 - 14463
Alignment:
| Q |
179 |
ttgtttggtagatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
||||||| | |||||||| ||||||||||||| |||| |||||||||| ||||||| | ||||||| |||||||||| |
|
|
| T |
14385 |
ttgtttgatggatggattggatggattttgtagtggatggattggatggatatggatctcatggatcatattgccaccc |
14463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 174 - 256
Target Start/End: Complemental strand, 41189669 - 41189587
Alignment:
| Q |
174 |
aaaaattgtttggtagatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgccacc |
256 |
Q |
| |
|
|||| ||||||| | |||||||| ||||||||||||| |||| |||||||||| ||||||| | ||||||| ||||||||| |
|
|
| T |
41189669 |
aaaatttgtttgatggatggattggatggattttgtagtggatggattggatggatatggatctcatggatcatattgccacc |
41189587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 199 - 257
Target Start/End: Original strand, 9129510 - 9129568
Alignment:
| Q |
199 |
atggattttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
|||||||||||| ||| ||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
9129510 |
atggattttgtagcggatggaatggatgaatatggatttggtggatcactttgccaccc |
9129568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 199 - 257
Target Start/End: Original strand, 9137617 - 9137675
Alignment:
| Q |
199 |
atggattttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
|||||||||||| ||| ||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
9137617 |
atggattttgtagcggatggaatggatgaatatggatttggtggatcactttgccaccc |
9137675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 203 - 257
Target Start/End: Complemental strand, 34365493 - 34365439
Alignment:
| Q |
203 |
attttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
|||||||| || | |||||||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
34365493 |
attttgtagtgaatggattggatggttatagatttggtggatcaaattgccaccc |
34365439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 257
Target Start/End: Complemental strand, 41397841 - 41397773
Alignment:
| Q |
189 |
gatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||| ||||| ||||||||| |||||| |||||||||| |
|
|
| T |
41397841 |
gatggattggatggattttgtagtggatggatcggatggatatggatttcatggatctaattgccaccc |
41397773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 257
Target Start/End: Complemental strand, 17894031 - 17893953
Alignment:
| Q |
179 |
ttgtttggtagatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
|||||||||||||||||| ||||||| || | |||| |||||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
17894031 |
ttgtttggtagatggattggatggatattatggtggatggattggatgtatatggatttgatggatcctattgccaccc |
17893953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 257
Target Start/End: Complemental strand, 43323796 - 43323718
Alignment:
| Q |
179 |
ttgtttggtagatggattagatggattttgtactggagggattggatgattatggatttggtggatcacattgccaccc |
257 |
Q |
| |
|
||||||| | |||||||| ||||||||||||| |||| |||||||||| ||| ||| | ||||||| |||||||||| |
|
|
| T |
43323796 |
ttgtttgatggatggattggatggattttgtagtggatggattggatggatatagatctcatggatcatattgccaccc |
43323718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University