View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5061_low_18 (Length: 251)

Name: NF5061_low_18
Description: NF5061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5061_low_18
NF5061_low_18
[»] chr5 (1 HSPs)
chr5 (1-239)||(27243767-27244006)


Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 27244006 - 27243767
Alignment:
1 cagtggaagtctttagattgatttttcaaccatcatcaagaaaacaatttgatgggatcgattgatcgatcaaatatcatttgtctctacatccttaac- 99  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      
27244006 cagtggaagtccttagactgatttttcaaccatcatcaagaaaacaatttgatgggatcgattgatcgatcaaatatcatttgtctctacatccttaata 27243907  T
100 gttaacaccgcattgtaaattggtgagagagtgatagtgctcttatgatagttgtaaacattgatctattattacctttgagtagtagcaaaggtcccca 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
27243906 gttaacaccgcattgtaaattggtgagagagtgatagtgctcttatgatagatgtaaacattgatctattattacctttgagtagtagcaaaggtcccca 27243807  T
200 tttccctctagtaataaaagatagaagtatggtgaatatt 239  Q
    |||||||||||||||||| |||||||||||||||||||||    
27243806 tttccctctagtaataaaggatagaagtatggtgaatatt 27243767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University