View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5062_low_11 (Length: 281)
Name: NF5062_low_11
Description: NF5062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5062_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 262
Target Start/End: Complemental strand, 50592630 - 50592383
Alignment:
| Q |
18 |
gcacagatcactaaatagctgtaacagtaaactcgcatgcacagaccgctggtttagtatacgtgtgagtcta---gcatttagaaacaaaaacatttgt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50592630 |
gcacagatcactaaatagctgtaacagtaaactcgcatgcacagaccgctggtttagtatacgtgtgagtctactagcatttagaaacaaaaacatttgt |
50592531 |
T |
 |
| Q |
115 |
gaggctaacatgcaaaaccaaacaaatgacaagaaaaacacaaggcagtgagggacagtgtgattatgatttctttctgacagaccaatttgataaaact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50592530 |
gaggctaacatgcaaaaccaaacaaatgacaagaaaaacacaaggcagtgagggacagtgtgattatgatttctttctgacagaccaatttgataaaact |
50592431 |
T |
 |
| Q |
215 |
ggcattaaaaccaatgtgatctgtttcatgatcgtgtatgatagtggc |
262 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50592430 |
gccattaaaaccaatgtgatctgtttcatgatcgtgtatgatattggc |
50592383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University