View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5062_low_12 (Length: 276)
Name: NF5062_low_12
Description: NF5062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5062_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 96 - 255
Target Start/End: Complemental strand, 45801525 - 45801366
Alignment:
| Q |
96 |
ggttttgtaatttgtatagttactttgaatcgatctttgtgaaattaagatcggagataagatcggtgataagatcagatgggcggaggtggagcaacaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45801525 |
ggttttgtaatttgtatagttactttgaatcgatctttgtgaaattaagatcggagataagatcggtgataagatcagatgggcggaggtggagcaacaa |
45801426 |
T |
 |
| Q |
196 |
ctaacgcggaggcgcagtatacgacggcgaagatatcggtatggtgggatatagagaact |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45801425 |
ctaacgcggaggcgcagtatacgacggcgaagatatcggtatggtgggatatagagaact |
45801366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 45801620 - 45801582
Alignment:
| Q |
1 |
cttctgtcacataaatcatcatcgatcaatcaatgagtg |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45801620 |
cttctgtcacataaatcatcatcgatcaatcaatgagtg |
45801582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University