View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5062_low_14 (Length: 240)
Name: NF5062_low_14
Description: NF5062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5062_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 18453222 - 18453450
Alignment:
| Q |
1 |
atagaaatggtgaaaaatcatatcatagaatttagtatatgacatgaatagaagggaatacatgggaacgtgtgtaaaaaatgtattgatagcttgtgat |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18453222 |
atagaaatggtgaaaattcatatcatagaagttagtatctgacatgaatagaagggaatacatgggaacgtgtggaaaaaatgtattgatagcttgtgat |
18453321 |
T |
|
| Q |
101 |
tcaggatttctttatagggtgattctgctgttattaattagtggtaatggttgtagtattggtgtcttttctttaggtagaacaatgttgcattgacgtg |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18453322 |
tcaggatttctttatagggtaattctgctgttattaattagtggtaatggttgtagtattggtgtcttttctttaggtagaacaatgttgcattgacgtg |
18453421 |
T |
|
| Q |
201 |
atgatttttgtatgtatacagatgatgat |
229 |
Q |
| |
|
||||||||||||||||| |||||||||| |
|
|
| T |
18453422 |
atgatttttgtatgtatgtagatgatgat |
18453450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University