View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5062_low_6 (Length: 398)
Name: NF5062_low_6
Description: NF5062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5062_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 18 - 371
Target Start/End: Original strand, 18039962 - 18040315
Alignment:
| Q |
18 |
attttttgtcgtttcatttctcacacaaacacgatctgaattccaaagaacaaaaaacatgcttacatgcatagcacgtccaaagaaactcgaagaagat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18039962 |
attttttgtcgtttcatttctcacacaaacacgatctgaattccaaagaacaaaaaacatgcttacatgcatagcacgtccaaagaaactcgaagaagat |
18040061 |
T |
 |
| Q |
118 |
tcagaatcaaacaacaatgcaaagagcgtaaaatccttgacatgtcagataaaagacatggcattgaaagcttcaggtgtatacaaaagctgtaatcctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18040062 |
tcagaatcaaacaacaatgcaaagagcgtaaaatctttgacatgtcagataaaagacatggcattgaaagcttcaggtgtatacaaaagctgtaatcctt |
18040161 |
T |
 |
| Q |
218 |
gtactcctgcaacccgcctccgaaacggtggctccgagtcagaagtttctgactcggagaagtttcggaggacgaggacatgggggaaggagatggaagc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18040162 |
gtactcctgcaacccgcctccgaaacggtggctccgagtcagaagtttctgactcggagaagtttcggaggacgaggacgtgggggaaggagatggaagc |
18040261 |
T |
 |
| Q |
318 |
taggttgaaggggatatcaagtggagaagggacgccgagttcgtcttcttcgtc |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18040262 |
taggttgaaggggatatcaagtggagaagggacgccaagttcgtcttcttcgtc |
18040315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University