View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5063-Insertion-11 (Length: 132)
Name: NF5063-Insertion-11
Description: NF5063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5063-Insertion-11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 13 - 132
Target Start/End: Original strand, 8439116 - 8439235
Alignment:
| Q |
13 |
atccttctgtgaccatcatagccatgctttctcaatcagagacccatttaaggcccatgcctcgagagttcgtgttcaaatcaattacttttccatcact |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8439116 |
atccttctgtgaccatcatagccatgctttctcaatcagagacccatttaaggcccatgcctcgagagttcgtgttcaaattaattacttttccatcact |
8439215 |
T |
 |
| Q |
113 |
ttcatttctttgtagcagta |
132 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
8439216 |
ttcatttctttgtagcagta |
8439235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University