View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5063_high_33 (Length: 239)

Name: NF5063_high_33
Description: NF5063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5063_high_33
NF5063_high_33
[»] chr1 (1 HSPs)
chr1 (22-239)||(45394365-45394582)


Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 22 - 239
Target Start/End: Original strand, 45394365 - 45394582
Alignment:
22 tacctttcatggtatcattgattgccaagaaatgatagattaaaatggtatcatggattgccaggtgaagatagattaaaatatcgataattgccagcaa 121  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45394365 tacctttcatggtatcattgattgccaggaaatgatagattaaaatggtatcatggattgccaggtgaagatagattaaaatatcgataattgccagcaa 45394464  T
122 agtaatttactatttgatacactcttctcaacacggattggactcttcttaagtgaacaactaagtgtaacatgagtaatataaccgttgatgaacaaat 221  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45394465 agtaatttactatttgatacactcttctcaacacggatttgactcttcttaagtgaacaactaagtgtaacatgagtaatataaccgttgatgaacaaat 45394564  T
222 taacggttgatattatat 239  Q
    |||| |||||||||||||    
45394565 taacagttgatattatat 45394582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University