View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5063_low_18 (Length: 293)
Name: NF5063_low_18
Description: NF5063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5063_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 20 - 284
Target Start/End: Original strand, 29613397 - 29613661
Alignment:
| Q |
20 |
ttcaatgttggaagaagtttctcatcactaggtttaattttcacttctttgtctaaccatacatttcctcttgttatattaggcttccaccataatttaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29613397 |
ttcaatgttggaagaagtttctcatcactaggtttaattttcacttctttgtctaaccatacatttcctcttgttatattaggcttccaccataatttaa |
29613496 |
T |
|
| Q |
120 |
tatattcttttctatggttccataattttgatgaggctcctattccaaacactatgtgtgaaatattggttttttgttccaacggtaattttggtatagg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29613497 |
tatattcttttctatggttccataattttgatgaggctcctattccaaacactatgtgtgaaatattggttttttgttccaacggtaattttggtatagg |
29613596 |
T |
|
| Q |
220 |
ttcaatttggtatttaactggagaaagtatgttagggtttttatcaaattgatgtgaagtattat |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29613597 |
ttcaatttggtatttaattggagaaagtatgttagggtttttatcaaattgatgtgaagtattat |
29613661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University