View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5063_low_24 (Length: 253)

Name: NF5063_low_24
Description: NF5063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5063_low_24
NF5063_low_24
[»] chr8 (1 HSPs)
chr8 (22-218)||(11212438-11212636)


Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 22 - 218
Target Start/End: Complemental strand, 11212636 - 11212438
Alignment:
22 ggttttgttgttctaagttgaagagaccaagttggaaggtttggttttggcttaagagtgttttgttttgtgataaaatgattgtgttggaaagagtgaa 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11212636 ggttttgttgttctaagttgaagagaccaagttggaaggtttggttttggcttaagagtgttttgttttgtgataaaatgattgtgttggaaagagtgaa 11212537  T
122 gtgaggtaagagaaggaagagaaaaaataggaacattgnnnnnnngaggttgtc-----gaagggaaaaatgttgaatgaaattggaagaaagataagta 216  Q
    ||||||||| ||||||||||||||||||||||||||||       |||||||||     |||||||||||||||||||||||||||||||||||||||||    
11212536 gtgaggtaatagaaggaagagaaaaaataggaacattg---ttttgaggttgtcggagggaagggaaaaatgttgaatgaaattggaagaaagataagta 11212440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University