View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5063_low_24 (Length: 253)
Name: NF5063_low_24
Description: NF5063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5063_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 22 - 218
Target Start/End: Complemental strand, 11212636 - 11212438
Alignment:
| Q |
22 |
ggttttgttgttctaagttgaagagaccaagttggaaggtttggttttggcttaagagtgttttgttttgtgataaaatgattgtgttggaaagagtgaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11212636 |
ggttttgttgttctaagttgaagagaccaagttggaaggtttggttttggcttaagagtgttttgttttgtgataaaatgattgtgttggaaagagtgaa |
11212537 |
T |
 |
| Q |
122 |
gtgaggtaagagaaggaagagaaaaaataggaacattgnnnnnnngaggttgtc-----gaagggaaaaatgttgaatgaaattggaagaaagataagta |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11212536 |
gtgaggtaatagaaggaagagaaaaaataggaacattg---ttttgaggttgtcggagggaagggaaaaatgttgaatgaaattggaagaaagataagta |
11212440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University