View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5063_low_25 (Length: 251)
Name: NF5063_low_25
Description: NF5063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5063_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 245
Target Start/End: Complemental strand, 52288701 - 52288466
Alignment:
| Q |
10 |
attattctcgacaaatactctatttactgcccacagattcctgtcttctttccaatctcttctgctaacatagataattgtagttcactgttaaatgaat |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52288701 |
attatgctcgacaaatactctatttactgcccacagattcctgtcttctttccaatctcttctgctaaaatagataattgtagttcactgttaaatgaat |
52288602 |
T |
 |
| Q |
110 |
tttgttttaaaaatatttaccttcttacaaggttaaccatcgagttctatatattcacttatagtatcttgtaagaaagaaatcaaataaatggctagga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52288601 |
tttgttttaaaaatatttaccttcttacaaggttaaccatcgagttctatatattcacttatagtatcttgtaagaaagaaatcaaataaatggctagga |
52288502 |
T |
 |
| Q |
210 |
gtgcgaagtagccaactcggttgatgagctgagaga |
245 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||| |
|
|
| T |
52288501 |
gtgcgaagcagccaactcggtcgatgagctgagaga |
52288466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University