View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5063_low_26 (Length: 250)
Name: NF5063_low_26
Description: NF5063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5063_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 1396638 - 1396857
Alignment:
| Q |
19 |
aaaagtacatctttcagtcactattataaatagaaaaacatatttatttattaaatgatatatgtggtctatttaactcaattagagtaggtatcacaat |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1396638 |
aaaagtacatctttcggtcactattataaatagaaaaacatatttatttattaaatgatatatgtggtctatttaactcagttagagtaggtatcacaat |
1396737 |
T |
 |
| Q |
119 |
ctcatttttaacacaattaaatgggcacnnnnnnnagcttattcttttattgatacatcatgtttatttgtaaacagctttggtctactttagtaggaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1396738 |
ctcatttttaacacaattaaatgggcactttttttagcttattcttttattgatacatcatgtttatttgtaaacagctttggtctactttagtaggaaa |
1396837 |
T |
 |
| Q |
219 |
agaaaatcacaatctagaat |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1396838 |
agaaaatcacaatctagaat |
1396857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 228
Target Start/End: Complemental strand, 1393133 - 1393059
Alignment:
| Q |
154 |
agcttattcttttattgatacatcatgtttatttgtaaacagctttggtctactttagtaggaaaagaaaatcac |
228 |
Q |
| |
|
||||||||||| |||| |||||| |||||||||||||||| ||||||||||| |||| ||||||||||||||||| |
|
|
| T |
1393133 |
agcttattcttgtatttatacatgatgtttatttgtaaacggctttggtctagtttaataggaaaagaaaatcac |
1393059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University