View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5063_low_33 (Length: 239)
Name: NF5063_low_33
Description: NF5063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5063_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 17 - 149
Target Start/End: Original strand, 34061903 - 34062035
Alignment:
| Q |
17 |
atcaaaatgaatgacacagaacaacaatgataaatccaatccctaaaatcaaataaaaattagannnnnnnaggaaaatgatgaattgatcacagcataa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34061903 |
atcaaaatgaatgacacagaacaacaatgataaatccaatccctaaaatcaaataaaaattagatttttttaggaaaatgatgaattgatcacagcataa |
34062002 |
T |
 |
| Q |
117 |
tcaattatggaataaagggtcaacaaatatgaa |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34062003 |
tcaattatggaataaagggtcaacaaatatgaa |
34062035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 183 - 217
Target Start/End: Original strand, 34062069 - 34062103
Alignment:
| Q |
183 |
ctcaccagaaatcaaggatatgtgggaatcccctg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34062069 |
ctcaccagaaatcaaggatatgtgggaatcccctg |
34062103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University