View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5063_low_34 (Length: 239)
Name: NF5063_low_34
Description: NF5063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5063_low_34 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 22 - 239
Target Start/End: Original strand, 45394365 - 45394582
Alignment:
| Q |
22 |
tacctttcatggtatcattgattgccaagaaatgatagattaaaatggtatcatggattgccaggtgaagatagattaaaatatcgataattgccagcaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45394365 |
tacctttcatggtatcattgattgccaggaaatgatagattaaaatggtatcatggattgccaggtgaagatagattaaaatatcgataattgccagcaa |
45394464 |
T |
|
| Q |
122 |
agtaatttactatttgatacactcttctcaacacggattggactcttcttaagtgaacaactaagtgtaacatgagtaatataaccgttgatgaacaaat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45394465 |
agtaatttactatttgatacactcttctcaacacggatttgactcttcttaagtgaacaactaagtgtaacatgagtaatataaccgttgatgaacaaat |
45394564 |
T |
|
| Q |
222 |
taacggttgatattatat |
239 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
45394565 |
taacagttgatattatat |
45394582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University