View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5064-Insertion-3 (Length: 146)
Name: NF5064-Insertion-3
Description: NF5064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5064-Insertion-3 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 5e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 5e-42
Query Start/End: Original strand, 8 - 146
Target Start/End: Original strand, 79027 - 79165
Alignment:
| Q |
8 |
ctagcgataataattattttactactctaaataaatttatttggagnnnnnnntgatagaaacnnnnnnnnnactgtagaaacatagtatcaaaagatta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
79027 |
ctagcgataataattattttactactctaaataaatttatttggagaaaaaaatgatagaaactttttttttcctgtagaaacatagtatcaaaagatta |
79126 |
T |
|
| Q |
108 |
tcatatgattggtaaatttatttcatcttattttgacaa |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
79127 |
tcatatgattggtaaatttatttcatcttattttgacaa |
79165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 1e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 6885812 - 6885767
Alignment:
| Q |
8 |
ctagcgataataattattttactactctaaataaatttatttggag |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6885812 |
ctagcgataataattattttactactctaaataaatttatttggag |
6885767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 99 - 145
Target Start/End: Original strand, 30659334 - 30659380
Alignment:
| Q |
99 |
aaaagattatcatatgattggtaaatttatttcatcttattttgaca |
145 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
30659334 |
aaaagattatcatatgattgcttaatttatttcatcttattttgaca |
30659380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 100 - 145
Target Start/End: Complemental strand, 5324284 - 5324239
Alignment:
| Q |
100 |
aaagattatcatatgattggtaaatttatttcatcttattttgaca |
145 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||| ||||||||| |
|
|
| T |
5324284 |
aaagattatcatatgattgataaatttattttgtctaattttgaca |
5324239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University