View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5064_high_13 (Length: 236)
Name: NF5064_high_13
Description: NF5064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5064_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 43612673 - 43612465
Alignment:
| Q |
14 |
aatgtttattaaatacatttgtatagaaatacttgtgatgttatcgcaataagttttttactgaatgtagcatttcgctttggaaaagcttacaacaatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43612673 |
aatgtttattaaatacatttgtatagaaatacttgtgatgttatcgcaataagttttttactgaatgtagcatttcgctttggaaaagcttacaacaatg |
43612574 |
T |
|
| Q |
114 |
gatgcgttaagaaattgaagacgaatgaggttaacaattgcatttgacttgtcttaacaatctcagcctaagtttagcattattatcagttgtagccttt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43612573 |
gatgcgttaagaaattgaagacgaatgaggttaacaattgcatttgatttgtcttaacaatctcagcctaagtttagcattattatcagttgtagccttt |
43612474 |
T |
|
| Q |
214 |
ggcttttgt |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
43612473 |
ggcttttgt |
43612465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University