View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5064_low_12 (Length: 241)
Name: NF5064_low_12
Description: NF5064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5064_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 89 - 222
Target Start/End: Complemental strand, 43515677 - 43515544
Alignment:
| Q |
89 |
ttttttaacaatcatcaatgaatcttctttgctagtattttacatgtatgccatttttatattaaaattttcttaacgtatttaggttgtatcgtcgtaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
43515677 |
ttttttaacaatcatcaatgaatcttctttgctagtattttacatgtatacaatttttatattaaaattttcttaacttatttaggttgtatcgttgtaa |
43515578 |
T |
 |
| Q |
189 |
cttaaatttcaaacctttctcgtatcacttattc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43515577 |
cttaaatttcaaacctttctcgtatcacttattc |
43515544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 43515718 - 43515682
Alignment:
| Q |
1 |
cctttacattctcattttcaattcctcaaattctgtc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43515718 |
cctttacattctcattttcaattcctcaaattctgtc |
43515682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University