View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5064_low_6 (Length: 277)
Name: NF5064_low_6
Description: NF5064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5064_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 7 - 113
Target Start/End: Complemental strand, 26324576 - 26324471
Alignment:
| Q |
7 |
tgagatgaattggggtccaagggaagggcctaaaggtccaaaacaaaaggatttttggaaaggagacgaacggtgagtcgtccttatgatattttttcac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
26324576 |
tgagatgaattggggtccaagggaagggcctaaaggtccaaaacaaaaggatttttggaaaggagacgaacggtgagtcgttcttatgat-gtttttcac |
26324478 |
T |
 |
| Q |
107 |
ccgtgat |
113 |
Q |
| |
|
||||||| |
|
|
| T |
26324477 |
ccgtgat |
26324471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 159 - 196
Target Start/End: Complemental strand, 26324359 - 26324322
Alignment:
| Q |
159 |
ggtagaaattttatatctcaattaggccttgtaataat |
196 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26324359 |
ggtagaaattttatatctcaattaggctttgtaataat |
26324322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University