View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5065-Insertion-15 (Length: 213)
Name: NF5065-Insertion-15
Description: NF5065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5065-Insertion-15 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 76 - 213
Target Start/End: Original strand, 52513106 - 52513242
Alignment:
| Q |
76 |
ttggtcttggagatgatggagatttgtagattccataatgataaaaatttataattgcatatactaattaagttgttaattaaaaggaaaaatgaagagg |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52513106 |
ttggtcttggagatgatggagatttgtagattccataatgataaaa-tttataattgcatatactaattaagttgttaattaaaaggaaaaatgaagagg |
52513204 |
T |
 |
| Q |
176 |
atcaagctaaaggtgttggttgaaaatcccaagatgag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52513205 |
atcaagctaaaggtgttggttgaaaatcccaagatgag |
52513242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 48
Target Start/End: Original strand, 52513051 - 52513087
Alignment:
| Q |
12 |
caactctataggatgtggtactggataaagaagaaac |
48 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
52513051 |
caactgtataggatggggtactggataaagaagaaac |
52513087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University