View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5065_high_1 (Length: 413)
Name: NF5065_high_1
Description: NF5065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5065_high_1 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 15 - 413
Target Start/End: Complemental strand, 45974670 - 45974273
Alignment:
| Q |
15 |
gaggaaagtgactttgtggttggagtgtcgttttcgattggagatttgatggagttgacgattttgtccttatcttgatctaatagctttttggatgatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45974670 |
gaggaaagtgactttgtggttggagtgtcgttttcgattggagatttgatggagttgacgattttgtccttatcttgatctaatagctttttggatgatt |
45974571 |
T |
|
| Q |
115 |
catccaatcctcgctccggaaattgacgcgggaaaaagtaagttgctctatgtggcattttcactcacgagcctcttgctgccacgtagcaaaccaagaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45974570 |
catccaatcctcgctccggaaattgacgcgggaaaaagtaagttgctctatgtggcattttcactcacgagcctcttgc-gccacgtagcaaaccaagaa |
45974472 |
T |
|
| Q |
215 |
acaaacggaaacttggtcgttactgacaccgtcctccttgctgttcttcctcttcttctttcctctacttatgcaaatctcttattgcaactctcaaata |
314 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||| | | || | ||| ||||||||||||||| || ||||||||||||||||||||| ||||||| |
|
|
| T |
45974471 |
acaaacggaaacttggccgttaccgacaccgtcctcttcgttgctgttcttcttcttctttcctcaacgcatgcaaatctcttattgcaacaatcaaata |
45974372 |
T |
|
| Q |
315 |
acagcacttgaactaattattatgcataatatatagttggaagctgaattgtattttactcttaagaaacttagaagacagattgataagtataatcgc |
413 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45974371 |
acagcacttcaactaattattatgcataatatatagttggaagctgaattgtattttactcttaagaaacttagaagacagattgataagtataatcgc |
45974273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University