View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5065_high_12 (Length: 240)
Name: NF5065_high_12
Description: NF5065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5065_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 17471214 - 17471436
Alignment:
| Q |
1 |
tctggtaacatgtttgtcgagaagatttacggtttcatacatgtctaaacctagttgtttgcgtttgtatgttactagtttcactatagattgaggcagt |
100 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17471214 |
tctggtgacatgtttgtctagaagatttacggtttcatacatgtctaaacctagttgtttgcgtttgtatgttactagtttcactatagattgaggcagt |
17471313 |
T |
|
| Q |
101 |
gatttttcaagagtggttatatcaacattcgattcaactattatatctgtacatcttgttagtagtttatcacatgttttaccacaaatgtttgctatag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17471314 |
gatttttcaagagtggttatatcaacattggattcaactattatatctgtacatctttttagtagtttatcacatgttttaccacaaatgtttgctatag |
17471413 |
T |
|
| Q |
201 |
aaagaaccaccaacatgtcatct |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
17471414 |
aaagaaccaccaacatgtcatct |
17471436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University