View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5065_high_6 (Length: 314)
Name: NF5065_high_6
Description: NF5065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5065_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 14 - 296
Target Start/End: Complemental strand, 39026471 - 39026189
Alignment:
| Q |
14 |
agaccatgtgcatgagatattattatatttataagaggttatgcatggtgtgtgacgtgttacattaatcattttatcattaaaaagctaagtataggta |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39026471 |
agaccatgtgcataagatattattatatttataagaggttatgcatggtgtgtgacgtgttacattaatcattttatcattaaaaagctaagtataggta |
39026372 |
T |
 |
| Q |
114 |
cagtagtttaagggatatagttaaaactagaattgtgaggactcgtgggatttggggtatgagctgtgaaagagagggaaaagtgaggacttcttgtgaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39026371 |
cagtagtttaagggatatagttaaaactagaattgtgaggactcgtgggatttggggtatgagctgtgaaagagagggaaaagtgaggacttcctgtgaa |
39026272 |
T |
 |
| Q |
214 |
gatcatgttatgctcccatgtgaattgtttgcatgcactatatgctttctttgctttgtccccaaaccattcccacatgtagg |
296 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39026271 |
gatcatgttatgcttccatgtgaattgtttgcatgcactatttgctttctttgctttgtccccaaaccattcccacatgtagg |
39026189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 222 - 293
Target Start/End: Complemental strand, 30722839 - 30722766
Alignment:
| Q |
222 |
tatgctcccatgtgaattgtttgcatgcactatat--gctttctttgctttgtccccaaaccattcccacatgt |
293 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||| |||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
30722839 |
tatgcgcccatgtgaattgattgcatgcactatgctagctttctttgctttgtccacaaaccattgccacatgt |
30722766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University