View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5065_low_15 (Length: 238)
Name: NF5065_low_15
Description: NF5065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5065_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 45678417 - 45678202
Alignment:
| Q |
1 |
ttgtcacgtttgcatggagttttgtttctattattaacgatgatggtatggttttacnnnnnnnnnaaggaacgatggttatatttattagcctgtctaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
45678417 |
ttgtcacgtttgcatggagttttgtttctattattaacgatgatggtatggttttacttttttta-aaggaacgatggttatatttattagcctgcctaa |
45678319 |
T |
|
| Q |
101 |
ttnnnnnnncaatatctttctatacaaaagaagagtttctatgaagtcaaagaaagtattagatagaattgacacaatgagtgtgattcaattggttaag |
200 |
Q |
| |
|
|| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45678318 |
ttaaaaaaacaatatatttctatacaaaagaagagtttctatgaagtcaaag----tattagatagaattgacacaacgagtgtgattcaattggttaag |
45678223 |
T |
|
| Q |
201 |
taacatcgagttggaactaaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45678222 |
taacatcgagttggaactaaa |
45678202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University