View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5065_low_9 (Length: 292)
Name: NF5065_low_9
Description: NF5065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5065_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 24 - 103
Target Start/End: Complemental strand, 5955434 - 5955355
Alignment:
| Q |
24 |
accccaatagctatccccccatctaacctaccatcactttcatcaccactcaatgttgatacaattttcagaaacttagt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5955434 |
accccaatagctatccccccatctaacctaccatcactttcatcaccactcaatgttgatacaattttcagaaacttagt |
5955355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 156 - 211
Target Start/End: Complemental strand, 5955302 - 5955247
Alignment:
| Q |
156 |
tgagataacctaaacttcctagaattaagagattcatttttcaatctcttcatctt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5955302 |
tgagataacctaaacttcctagaattaagagattcatttttcaatctcttcatctt |
5955247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University