View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5066_high_5 (Length: 354)
Name: NF5066_high_5
Description: NF5066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5066_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 18 - 138
Target Start/End: Complemental strand, 42067127 - 42067007
Alignment:
| Q |
18 |
aacaaaatatgggtggcttaaacgataaagttcttgtaaggatcagttcctttcacatgggttagttaaaagtgaggactaggaagtatgggtggcttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42067127 |
aacaaaatatgggtggcttaaacgataaagttcttgtaaggatcagttcctttcacatgggttagttaaaagtgaggactaggaagtatgggtggcttat |
42067028 |
T |
 |
| Q |
118 |
actcatataaaatatatatga |
138 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42067027 |
actcatataaaatatatatga |
42067007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 271 - 319
Target Start/End: Complemental strand, 42066874 - 42066826
Alignment:
| Q |
271 |
tccactacaataagaatgataagatttaaatctttatttgataatgtac |
319 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
42066874 |
tccactacaataagaatgatatgatttaaatctttatctgataatgtac |
42066826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University