View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5066_low_5 (Length: 373)
Name: NF5066_low_5
Description: NF5066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5066_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 202 - 357
Target Start/End: Complemental strand, 52518952 - 52518797
Alignment:
| Q |
202 |
ctaagggctgaatatattaagttttgaatggcatcaatatcttgttttagtaagagtccattgcccatgaaagagacagctttgagccatggtgaatatc |
301 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52518952 |
ctaagggctgaatatattaagttgtgaatggcatcaacatcttgttttagtaagagtccattacccatgaaagagacagctttgagccatggtgaatatc |
52518853 |
T |
|
| Q |
302 |
ctccacctatggcaacttatgaggaggttgtagacaatcccaagctcttcatactt |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52518852 |
ctccacctatggcaacttatgaggaggttgtagacaatcccaagctcttcatactt |
52518797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 10 - 50
Target Start/End: Complemental strand, 52519140 - 52519100
Alignment:
| Q |
10 |
attattctcattaatgtttttgttttccctatctacaaata |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52519140 |
attattctcattaatgtttttgttttccctatctacaaata |
52519100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University