View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5067_high_13 (Length: 325)
Name: NF5067_high_13
Description: NF5067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5067_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 38762439 - 38762728
Alignment:
| Q |
18 |
catgtatgtgttggttatgtataaagtctgtaaaacctagttcaactgccgaagttgttggttgaacatctttacttgagtttgaacttgaacctcacag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
38762439 |
catgtatgtgttggttatgtataaagtctgtaaaacctagttcaattgccgaagttgttggttgaacatctttactcgagtttgaacttgaaccttgcag |
38762538 |
T |
|
| Q |
118 |
ttatatgtgagagtcggtgtttaccacttcttttacacaccaaaacaaaaactatataatatataatgaaatttgttgatctatgatcaggatcacatcg |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762539 |
ttatatgtgagagtctgtgtttaccacttcttttacacaccaaaacaaaaactatataatatataatgaaatttgttgatctatgatcaggatcacatcg |
38762638 |
T |
|
| Q |
218 |
agtttggacatatatggtattgctctaataaacacttctgcaactttggccgctgccactactaactgtctcccagtgattaccttcttc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762639 |
agtttggacatatatggtattgctctaataaacacttctgcaactttggccgctgccactactaactgtctcccagtgattaccttcttc |
38762728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University