View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5067_high_21 (Length: 254)
Name: NF5067_high_21
Description: NF5067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5067_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 32 - 203
Target Start/End: Complemental strand, 40207284 - 40207112
Alignment:
| Q |
32 |
catagggcatag-tgaattgaatgggggtaaatgcagcatgaggtgctttatttccaatatttaactcatgcagtggggtattagcaacttattggtatt |
130 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40207284 |
catagggcataggtgaattgaatgggggtaaatgcagcatgagttgctttatttccaatatttaactcatgcagtggggtattagcaacttattggtatt |
40207185 |
T |
|
| Q |
131 |
tggtagaagtacttaattctttaatgtggtaatcatatgatgggggtaacgtcggtcttcgagggaccattta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
40207184 |
tggtagaagtacttaattctttaatgtggtaatcatatgatgggggtaacgtcggtcttcaaggcaccattta |
40207112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University