View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5067_high_26 (Length: 240)
Name: NF5067_high_26
Description: NF5067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5067_high_26 |
 |  |
|
| [»] chr2 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 104 - 240
Target Start/End: Original strand, 37217794 - 37217930
Alignment:
| Q |
104 |
acaagtcagggtggattttctattatctaacggtaaaactatttcaaaattgagtcaaccttgcatgttaggattcaaaaggaagcctatccgctccgcc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37217794 |
acaagtcagggtggattttctattatctaatggtaaaactatttcaagattgagtcaaccttgcatgttaggattcaaaaggaagcctatccgctccgcc |
37217893 |
T |
 |
| Q |
204 |
taatcatgaatttcctcaaaattgctcctcccattac |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37217894 |
taatcatgaatttcctcaaaattgctcctcccattac |
37217930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 110 - 240
Target Start/End: Complemental strand, 5418152 - 5418027
Alignment:
| Q |
110 |
cagggtggattttctattatctaacggtaaaactatttcaaaattgagtcaaccttgcatgttaggattcaaaaggaagcctatccgctccgcctaatca |
209 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||||||| ||| ||||||||||||||||||||| ||| || ||| | |||| ||| |||||||| |
|
|
| T |
5418152 |
cagggtggattttctattgtttaatggtaaaactattgcaagcttgagtcaaccttgcatgttaagatacagaagcgaaccta-----tccacctaatca |
5418058 |
T |
 |
| Q |
210 |
tgaatttcctcaaaattgctcctcccattac |
240 |
Q |
| |
|
||| ||| ||||| |||||||||| |||||| |
|
|
| T |
5418057 |
tgacttttctcaagattgctcctctcattac |
5418027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 37217709 - 37217746
Alignment:
| Q |
19 |
ggagatgtcaaactactgatgaaaattgcagttcagag |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37217709 |
ggagatgtcaaactactgatgaaaattgcagttcagag |
37217746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University