View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5067_high_29 (Length: 231)
Name: NF5067_high_29
Description: NF5067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5067_high_29 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 231
Target Start/End: Complemental strand, 9303386 - 9303166
Alignment:
| Q |
11 |
cagagaggagaagatctgcggacggtgtcgtagcaaatcatgcattcgacagtgcctttggtgagcttgtcctgaatctcttgcagaagttgaggtaata |
110 |
Q |
| |
|
|||| ||| ||||||||||| || ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9303386 |
cagataggggaagatctgcgcacaatgtcgtagcaaatcatgcattcgacggtgcctttggtaagcttgtcctgaatctcttgcagaagttgaggtaata |
9303287 |
T |
|
| Q |
111 |
actggttggtagttgaggatggtctaggagtccattgctgacgacgacgaggaaccctattatccctccgttggaagctcataagtgggagtgattcttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9303286 |
actggttggtagttgaggatggtctaggagtccattgctgacgacgacgaggaaccctattatccctccgttggaagctcataagtgggagtgattcttc |
9303187 |
T |
|
| Q |
211 |
tgtaactgtaatgattaaatt |
231 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9303186 |
tgtaactgtaatgattaaatt |
9303166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 52 - 192
Target Start/End: Complemental strand, 21761557 - 21761418
Alignment:
| Q |
52 |
gcattcgacagtgcctttggtgagcttgtcctgaatctcttgcagaagttgaggtaataactggttggtagttgaggatggtctaggagtccattgctga |
151 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21761557 |
gcattcgacggtgcctttggtgagcttgtcctgaatctcttgcagaagttgaggtaataactggttggtagttgaggatggtcta-gagtccattgctga |
21761459 |
T |
|
| Q |
152 |
cgacgacgaggaaccctattatccctccgttggaagctcat |
192 |
Q |
| |
|
|||||| ||||||| || || ||||| ||||||||||||| |
|
|
| T |
21761458 |
cgacgatgaggaactttaatacccctcggttggaagctcat |
21761418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 52 - 162
Target Start/End: Original strand, 18655072 - 18655181
Alignment:
| Q |
52 |
gcattcgacagtgcctttggtgagcttgtcctgaatctcttgcagaagttgaggtaataactggttggtagttgaggatggtctaggagtccattgctga |
151 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18655072 |
gcattcgacggtgcctttggtgagcttgtcctgaatctcttgcagaagttgaggtaataactggttggtagttgaggatggtcta-gagtccattgctga |
18655170 |
T |
|
| Q |
152 |
cgacgacgagg |
162 |
Q |
| |
|
||||||||||| |
|
|
| T |
18655171 |
cgacgacgagg |
18655181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University