View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5067_high_30 (Length: 219)

Name: NF5067_high_30
Description: NF5067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5067_high_30
NF5067_high_30
[»] scaffold0039 (1 HSPs)
scaffold0039 (1-209)||(42828-43036)
[»] scaffold0006 (1 HSPs)
scaffold0006 (1-137)||(233035-233171)
[»] chr4 (1 HSPs)
chr4 (28-149)||(43232622-43232743)


Alignment Details
Target: scaffold0039 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: scaffold0039
Description:

Target: scaffold0039; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 43036 - 42828
Alignment:
1 tttattcaccttcctaccactggtgctgcttatacctggcaaaatggtagaagtggcagaagatttactgaaaggaggttggatagatgtatatgtaatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
43036 tttattcaccttcctaccactggtgctgcttatacctggcaaaatggtagaagtggcagaagatttattgaaaggaggttggatagatgtatatgtaatc 42937  T
101 aactatggttagatatgtgctcttctatttcagtttctactctgttaaggtcctgctcagatcactatcctctattatttgagtttgaagcaaatcaaca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||    
42936 aactatggttagatatgtgctcttctatttcagtttctactctgttaaggtcctgctcagatcactatcctttattatttgagtttgaagaaaatcaaca 42837  T
201 caaattcat 209  Q
    |||||||||    
42836 caaattcat 42828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 233171 - 233035
Alignment:
1 tttattcaccttcctaccactggtgctgcttatacctggcaaaatggtagaagtggcagaagatttactgaaaggaggttggatagatgtatatgtaatc 100  Q
    |||||||| || ||||||||||||||    | ||| |||| |||||| || ||||| |||||||| |||||||| ||  | |||||||| |||||||| |    
233171 tttattcatctccctaccactggtgcataatttacttggcgaaatggaaggagtggtagaagattcactgaaagaagacttgatagatgcatatgtaacc 233072  T
101 aactatggttagatatgtgctcttctatttcagtttc 137  Q
    ||  ||||||  |||||||||| ||||| ||||||||    
233071 aatcatggttgaatatgtgctcctctatatcagtttc 233035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 149
Target Start/End: Original strand, 43232622 - 43232743
Alignment:
28 gcttatacctggcaaaatggtagaagtggcagaagatttactgaaaggaggttggatagatgtatatgtaatcaactatggttagatatgtgctcttcta 127  Q
    |||| ||| ||||||||||| |||||||| || ||||| |||||||| |  || |||||  | ||||| ||||| || ||| | ||||||||| ||||||    
43232622 gcttttacttggcaaaatgggagaagtggtaggagattcactgaaagaatattagataggagcatatgcaatcagctttggctggatatgtgcacttcta 43232721  T
128 tttcagtttctactctgttaag 149  Q
    |||| |||| ||||||| ||||    
43232722 tttctgtttgtactctgctaag 43232743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University