View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5067_low_22 (Length: 250)
Name: NF5067_low_22
Description: NF5067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5067_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 37217982 - 37218217
Alignment:
| Q |
1 |
cttttgaaaactccctcaaaatattttgcgatggttaaaatccttgcaaaatggcttaaaacctgccacaatccaaatgcannnnnnnnccgtagtttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37217982 |
cttttgaaaactccctcaaaatattttgcgatggttaaaatcctcgcaaaatggcttaaaacctgccacaatccaaatgca-tttttgtccgtagtttcc |
37218080 |
T |
 |
| Q |
101 |
aataagaactaagaaggaatattcaaatcctagaacattatgagtaattttattttcaannnnnnnagaggtttctttacaatcatttgttgaacgctag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
37218081 |
aataagaactaagaaggaatattcaaatcctagaacattatgagtaattttattttcattttttttagaggtttctttataatcatttgttgaacgctag |
37218180 |
T |
 |
| Q |
201 |
ataaacatctcttcgttatatttattaccccacatat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37218181 |
ataaacatctcttcgttatatttattaccccacatat |
37218217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University